GC Content Calculator: GC %, Base Counts, Primer Tm and GC Plot
Paste a DNA or RNA sequence (plain or FASTA) to get its GC and AT content, base counts, GC skew, three melting temperature estimates (Wallace, basic and salt-adjusted), molecular weight, a primer check and a sliding-window GC plot.
How it works
GC content (%) = (G + C) ÷ N × 100, where N = A + C + G + T (or U) · GC skew = (G − C) ÷ (G + C) · Wallace Tm = 4 × (G + C) + 2 × (A + T) °C · Basic Tm (14+ bases) = 64.9 + 41 × (G + C − 16.4) ÷ N · Salt-adjusted Tm = 81.5 + 0.41 × %GC − 675 ÷ N + 16.6 × log₁₀[Na⁺ in mol/L] · MW (5′-OH DNA) = 313.21·A + 304.2·T + 289.18·C + 329.21·G − 61.96 g/mol
GC content is the share of bases in a DNA or RNA sequence that are guanine (G) or cytosine (C). The calculator counts only definite bases: FASTA header lines, spaces, numbers and ambiguity codes such as N are skipped, so the percentage is based on known bases. A G–C pair forms three hydrogen bonds and stacks more strongly than an A–T pair, so GC-rich DNA melts at a higher temperature. Across genomes GC content ranges from below 20% to above 70%, and for PCR primers 40–60% is the usual target. Three melting temperature (Tm) estimates are shown for DNA. The Wallace rule (4 °C per G or C, 2 °C per A or T) is a quick rule for short oligos; it overestimates above about 20 bases and is not shown beyond 30. For 14 bases or more, the basic GC formula used by OligoCalc and UGENE, 64.9 + 41 × (G + C − 16.4) ÷ N, assumes about 50 nM primer and 50 mM Na⁺. The salt-adjusted formula of Marmur, Schildkraut and Lifson adds 16.6 × log₁₀ of the sodium concentration, so you can change the salt. All three ignore base order; nearest-neighbor tools that model each base pair step are more accurate for primer design. The primer check applies common design rules: 18–22 bases, 40–60% GC, a Tm of 52–58 °C and a GC clamp of 1 to 3 G or C bases in the last five bases at the 3′ end. For sequences of 40 bases or more a sliding-window plot shows where the GC content rises and falls, which helps spot GC-rich regions that are hard to amplify. The molecular weight is OligoCalc’s anhydrous formula for a synthetic single-stranded oligo with a 5′-OH; add 79.0 g/mol for a 5′ phosphate.
Worked example
The default primer ATGCGCGTATATCGGCTAAGGCC has 23 bases: A = 5, C = 6, G = 7 and T = 5. G + C = 13, so the GC content is 13 ÷ 23 × 100 = 56.5% and the AT content is 43.5%. The GC skew is (7 − 6) ÷ 13 = 0.077. The Wallace rule gives 4 × 13 + 2 × 10 = 72 °C, the basic formula gives 64.9 + 41 × (13 − 16.4) ÷ 23 = 58.8 °C, and the salt-adjusted formula at 50 mM Na⁺ gives 81.5 + 0.41 × 56.52 − 675 ÷ 23 + 16.6 × log₁₀(0.05) = 53.7 °C. Its molecular weight is 5 × 313.21 + 5 × 304.2 + 6 × 289.18 + 7 × 329.21 − 61.96 = 7,064.64 g/mol. As a primer it passes the 40–60% GC check, but its last five bases (AGGCC) hold 4 G or C, one more than the guideline of 3; its basic Tm of 58.8 °C is just above the 52–58 °C range, and at 23 bases it is one base longer than 18–22.
Sources: TmCalculator (R) Tm_GC documentation: GC-based Tm formulas, incl. Marmur–Schildkraut–Lifson salt correction · Wikipedia: GC-content (genome GC values) · OligoCalc (Kibbe 2007): basic Tm and anhydrous molecular weight formulas · UGENE documentation: melting temperature (64.9 + 41 × (G + C − 16.4) ÷ N) · PREMIER Biosoft: PCR primer design guidelines (length, GC, Tm, GC clamp)
Frequently asked questions
How do you calculate GC content?
Count the G and C bases, divide by the total number of bases and multiply by 100. A 20-base primer with 9 G or C bases is 9 ÷ 20 × 100 = 45% GC. Ambiguity codes such as N are left out of both the count and the total.
What is a good GC content for PCR primers?
Most primer design guides recommend 40–60% GC, a length of 18–22 bases and a melting temperature of about 52–58 °C. The two primers of a pair should have Tm values within about 5 °C of each other.
What is a GC clamp?
It is one or more G or C bases at the 3′ end of a primer, which help the end bind firmly so the polymerase can extend it. Guidelines suggest no more than 3 G or C bases in the last five, because a very GC-rich 3′ end raises the risk of mispriming.
Why do Tm calculators give different answers?
They use different formulas and assumptions. The Wallace rule and GC formulas only count bases, while nearest-neighbor methods also use base order and the primer, Na⁺ and Mg²⁺ concentrations. Differences of 5 °C or more between tools are normal, so compare primers with the same method.
What does GC skew tell you?
GC skew, (G − C) ÷ (G + C), shows whether one strand carries more G than C. In bacterial genomes the skew changes sign at the origin and terminus of replication, so a cumulative skew plot is used to locate them.
Does GC content differ between organisms?
Yes, widely. The human genome averages about 41% GC (35–60% in different 100-kb stretches), baker’s yeast about 38% and Arabidopsis about 36%, while the malaria parasite Plasmodium falciparum is only about 20% GC and Streptomyces coelicolor reaches 72%.
Related calculators
Educational estimate, not laboratory advice. Verify Tm and primer settings with your polymerase supplier’s recommendations.