Reverse Complement & DNA Sequence Tool
Reverse complement, complement or reverse of DNA or RNA — paste one sequence or several FASTA records — with IUPAC codes, DNA/RNA output, case kept, grouping in blocks or codons, plus length, base counts, GC content, basic and salt-adjusted Tm, molecular weight and a palindrome check.
How it works
complement: A↔T (U), C↔G; IUPAC R↔Y, K↔M, B↔V, D↔H, with S, W, N unchanged · reverse complement = reverse of the complement, written 5′→3′ · GC% = (G + C) ÷ length · basic Tm = 2(A+T) + 4(G+C) under 14 nt, else 64.9 + 41(G+C − 16.4) ÷ N · salt-adjusted Tm = 100.5 + 41(G+C) ÷ N − 820 ÷ N + 16.6·log₁₀[Na⁺] · ssDNA MW = 313.21·A + 289.18·C + 329.21·G + 304.2·T − 61.96
DNA strands are antiparallel, so the sequence of the opposite strand read 5′→3′ is the reverse complement — what you need to design a reverse primer, find a motif on the other strand, or check what a sequencing read from the far end should look like. Paste a plain sequence or several FASTA records; spaces, line breaks and position numbers are ignored, IUPAC ambiguity codes complement in pairs (R purine ↔ Y pyrimidine, and so on) and unknown letters are flagged rather than silently dropped. You can make the complement or the plain reverse the main result, write the output as DNA or RNA, keep lower-case soft-masked regions, split it into blocks of 10 or codons and label the 5′ and 3′ ends. Alongside the strands you get the base counts, GC content, the basic and salt-adjusted melting temperatures that OligoCalc uses, the oligo’s molecular weight (5′-OH, as synthesised), the first ATG on each strand and whether the sequence is palindromic, like a restriction site. For PCR primers, the primer Tm calculator gives nearest-neighbour thermodynamics.
Worked example
ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG is 39 nt (13 codons) with 22 G or C, so 56.4% GC. Its reverse complement is CTATCGGGCACCCTTTCAGCGGCCCATTACAATGGCCAT. Basic Tm = 64.9 + 41 × (22 − 16.4) ÷ 39 = 70.8 °C; at 50 mM Na⁺ the salt-adjusted Tm is 100.5 + 41 × 22 ÷ 39 − 820 ÷ 39 + 16.6 × log₁₀(0.05) = 81.0 °C. As a single-stranded oligo it weighs 12,112.9 g/mol and the first ATG is at position 1.
Sources: IUPAC-IUB — Nomenclature for incompletely specified bases in nucleic acid sequences · OligoCalc — oligonucleotide properties calculator (Tm and molecular weight formulas) · Sequence Manipulation Suite — Reverse Complement
Frequently asked questions
Which one do I use for a reverse primer?
The reverse complement of the 3′ end of your target, written 5′→3′ as you would order it. Turn on “Show 5′ and 3′ ends” to see the orientation spelled out.
What about RNA?
Sequences with U are read as RNA and the output keeps U. Choose “DNA (T)” or “RNA (U)” under Output as to convert between them, for example to get the DNA template of an siRNA.
What is the difference between the complement and the reverse complement?
The complement swaps each base for its partner but keeps the order, so it reads 3′→5′ under the original. The reverse complement also reverses it so it reads 5′→3′, the way sequences are written by convention.
Can I convert several sequences at once?
Yes — paste them in FASTA format, each starting with a line that begins with “>”. The results show the first record and a table lists every sequence with its length, GC content and converted sequence.
What do letters like R, Y or N mean?
They are IUPAC ambiguity codes: R is A or G (purine), Y is C or T (pyrimidine), S is G or C, W is A or T, K is G or T, M is A or C, B/D/H/V stand for three bases and N for any base. Each is replaced by the code for the complementary set.
Related calculators
This calculator is for educational purposes. Double-check important results before acting on them.